Stem-loop sequence ssc-mir-2483

AccessionMI0022167 (change log)
DescriptionSus scrofa miR-2483 stem-loop
Gene family MIPF0001532; mir-2483
Literature search

3 open access papers mention ssc-mir-2483
(6 sentences)

Stem-loop
   --          cg       u    c      -gg u 
5'   ugaaaaguuc  ucaacca ccag uguuug   g g
     ||||||||||  ||||||| |||| ||||||   | a
3'   auuuuuuaag  aguuggu gguc acaaac   c u
   uc          ag       u    u      aaa g 
Get sequence
Deep sequencing
73 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 117608201-117608276 [-]
sense
ENSSSCT00000022026 ; ssc-mir-2483.1-201; exon 1
Database links

Mature sequence ssc-miR-2483

Accession MIMAT0025390
Sequence

45 - 

aaacaucugguugguugagaga

 - 66

Get sequence
Deep sequencing24 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).