Stem-loop sequence xtr-mir-190

AccessionMI0022169
DescriptionXenopus tropicalis miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   --   u   u    -cu       u       a     uu  a 
5'   ccg ggu cugu   gauaugu ugauauu gguug  uu c
     ||| ||| ||||   ||||||| ||||||| |||||  || u
3'   ggu ccg gaca   uuauaca acuauaa ucagc  aa a
   cc   c   c    ucg       u       a     uc  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173419.1: 200488-200573 [-]
sense
ENSXETT00000059618 ; xtr-mir-190-201; exon 1

Mature sequence xtr-miR-190

Accession MIMAT0025392
Sequence

14 - 

ugauauguuugauauuagguu

 - 34

Get sequence
Evidence not experimental

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).