Stem-loop sequence pol-let-7b

AccessionMI0022190 (change log)
DescriptionParalichthys olivaceus let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention pol-let-7b
(3 sentences)

Stem-loop
   -u                     uca  g  g    uuu 
5'   gagguaguagguugugugguu   gg uu ugau   a
     |||||||||||||||||||||   || || ||||    
3'   uuccgucauccaacauaucaa   uc ag acua   c
   cc                     ---  g  g    ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-let-7b-5p

Accession MIMAT0025414
Sequence

1 - 

ugagguaguagguugugugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-let-7b-3p

Accession MIMAT0025415
Sequence

56 - 

cuauacaaccuacugccuucc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1