Stem-loop sequence pol-let-7a

AccessionMI0022191 (change log)
DescriptionParalichthys olivaceus let-7a stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention pol-let-7a
(5 sentences)

Stem-loop
   -u                     --------u       gg 
5'   gagguaguagguuguaugguu         gugggau  a
     |||||||||||||||||||||         |||||||  g
3'   uuccgucauccaacauaucaa         cauccua  u
   cc                     uaggggacu       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-let-7a-5p

Accession MIMAT0025416
Sequence

1 - 

ugagguaguagguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-let-7a-3p

Accession MIMAT0025417
Sequence

56 - 

cuauacaaccuacugccuucc

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1