Stem-loop sequence pol-let-7d

AccessionMI0022192 (change log)
DescriptionParalichthys olivaceus let-7d stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention pol-let-7d
(4 sentences)

Stem-loop
   --u   g   uu            -  gcauaaua 
5'    gag uag  gguuguaugguu uc        a
      ||| |||  |||||||||||| ||        a
3'    uuc auc  ccaacaugucaa ag        c
   ccu   g   uu            u  aggcacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pol-let-7d-5p

Accession MIMAT0025418
Sequence

1 - 

ugagguaguugguuguaugguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence pol-let-7d-3p

Accession MIMAT0025419
Sequence

49 - 

cuguacaaccuucuagcuuucc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1