Stem-loop sequence gga-mir-6542

AccessionMI0022359 (change log)
DescriptionGallus gallus miR-6542 stem-loop
Stem-loop
   agcggccccucguu    ----a    gaauuac     g     -    gc      cag   --ca ug cgu 
5'               cccc     ucac       cuggc ccagu gucu  cagcau   ccc    g  c   c
                 ||||     ||||       ||||| ||||| ||||  ||||||   |||    |  |    
3'               gggg     agug       gaccg gguca caga  gucgug   ggg    c  g   a
   --------------    ccuac    ---acgu     a     u    -a      aca   caac gu acc 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 4430921-4431047 [+]
sense
ENSGALT00000021648 ; SRF-201; 3'UTR (exon 3)
Database links

Mature sequence gga-miR-6542-5p

Accession MIMAT0025589
Sequence

42 - 

gucugccagcaucagccccagu

 - 63

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6542-3p

Accession MIMAT0025590
Sequence

80 - 

acgggacagugcugaagacua

 - 100

Get sequence
Deep sequencing87 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).