Stem-loop sequence gga-mir-6544

AccessionMI0022360 (change log)
DescriptionGallus gallus miR-6544 stem-loop
Stem-loop
   uuccguaagaa  a  -   --    agau           -  ug a     -  uu 
5'            cu gg gcu  ugua    ucagaaaagga ua  a uuguc cu  c
              || || |||  ||||    ||||||||||| ||  | ||||| ||   
3'            ga cu cga  gcgu    agucuuuucuu au  u aacag gg  a
   ------gagaa  a  g   cu    -gac           u  gu g     u  ug 
Get sequence
Deep sequencing
243 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 24455285-24455390 [-]
sense
ENSGALT00000013933 ; INO80-201; exon 31
Database links

Mature sequence gga-miR-6544-5p

Accession MIMAT0025591
Sequence

27 - 

uucagaaaaggauaugaauugu

 - 48

Get sequence
Deep sequencing9 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6544-3p

Accession MIMAT0025592
Sequence

64 - 

aaguuguauuucuuuucugacagu

 - 87

Get sequence
Deep sequencing234 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).