Stem-loop sequence gga-mir-6546

AccessionMI0022362 (change log)
DescriptionGallus gallus miR-6546 stem-loop
Stem-loop
   cagugcuggugcugucugugcagacucaca     -u         g     cu           u   c 
5'                               gggca  guccugcag agcgc  cugagcucccc cug u
                                 |||||  ||||||||| |||||  ||||||||||| |||  
3'                               cccgu  cgggacguc ucgug  gacuugagggg gac u
   -----------------------ucgucua     cu         g     uc           -   c 
Get sequence
Deep sequencing
82 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 36448362-36448478 [-]
intergenic
Database links

Mature sequence gga-miR-6546-5p

Accession MIMAT0025595
Sequence

44 - 

aggagcgccucugagcuccccu

 - 65

Get sequence
Deep sequencing66 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6546-3p

Accession MIMAT0025596
Sequence

78 - 

ggaguucagcugugcugcugc

 - 98

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).