Stem-loop sequence gga-mir-6547

AccessionMI0022363 (change log)
DescriptionGallus gallus miR-6547 stem-loop
Stem-loop
   cgagua    gcc  c      -aa      a  u  -   c       cg    g g g   u 
5'       ccac   ga gggggc   gguggg ug gg gga gggguga  ggga c c gug c
         ||||   || ||||||   |||||| || || ||| |||||||  |||| | | |||  
3'       ggug   cu ccccug   ucaccc ac cu ccu ccccacu  cccu g g uac c
   ---gua    -aa  a      gac      -  -  a   -       ca    g - a   c 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr27: 4660683-4660802 [+]
sense
ENSGALT00000029714 ; ERBB2-201; 3'UTR (exon 10)
Database links

Mature sequence gga-miR-6547-5p

Accession MIMAT0025597
Sequence

26 - 

gugggauguggggacgggguga

 - 47

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6547-3p

Accession MIMAT0025598
Sequence

81 - 

accccuccauccacccacuca

 - 101

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).