Stem-loop sequence gga-mir-6550

AccessionMI0022367 (change log)
DescriptionGallus gallus miR-6550 stem-loop
Stem-loop
   ----------   u c    a                 c   -aa c  ug ugc 
5'           gcu g aggu ggagcuucaaagcagcc agg   g gc  c   a
             ||| | |||| ||||||||||||||||| |||   | ||  |    
3'           cga c uuca ccuugaaguuucgucgg ucc   c cg  g   a
   uccuucuuca   c -    c                 c   cac u  gu caa 
Get sequence
Deep sequencing
71 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 19176435-19176534 [+]
sense
ENSGALT00000045084 ; FEM1B-201; intron 1
Database links

Mature sequence gga-miR-6550-5p

Accession MIMAT0025605
Sequence

20 - 

aaagcagcccaggaagcgcu

 - 39

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6550-3p

Accession MIMAT0025606
Sequence

53 - 

gcuccacccucggcugcuuuga

 - 74

Get sequence
Deep sequencing69 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).