Dead miRNA entry

miRNA accession:
MI0022368
miRNA ID:
gga-mir-3607
Comment:
The mir-3607 locus overlaps with an annotated snoRNA, SNORD138 (PMID:24174566). On inspection, the pattern of conservation of the locus in vertebrates suggests the snoRNA annotation is more likely. The pattern of deep sequencing reads mapping to the locus in human is also not supportive of the microRNA annotation.

Previous miRNA entry

Stem-loop sequence gga-mir-3607

AccessionMI0022368 (change log)
DescriptionGallus gallus miR-3607 stem-loop
Gene family MIPF0001566; mir-3607
Stem-loop
   --u uc   cccuau   cuuau         augau    -          g   ag 
5'    g  cuu      agc     augguacau     gagc uuugcaguau agu  a
      |  |||      |||     |||||||||     |||| |||||||||| |||   
3'    c  gaa      ucg     uaccgugua     uucg aaaugucgua uua  a
   ucu gu   ----cc   --uau         -gucu    c          g   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-3607-5p

Accession MIMAT0025607
Sequence

26 - 

uacauaugaugagcuuugcagu

 - 47

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-3607-3p

Accession MIMAT0025608
Sequence

67 - 

cuguaaacgcuuucugaugugcc

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).