Stem-loop sequence gga-mir-6551

AccessionMI0022369 (change log)
DescriptionGallus gallus miR-6551 stem-loop
Stem-loop
   g     uuuacu             c  u        -       g   gag  au 
5'  guggu      ggggaggggagag gg gcaucucu gcagccc cau   cc  g
    |||||      ||||||||||||| || |||||||| ||||||| |||   ||  u
3'  caccg      ucccuucccuuuc cc uguagaga ugucggg gug   gg  g
   -     -uguuc             -  u        g       -   --a  gc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 9400612-9400719 [-]
sense
ENSGALT00000011206 ; BAIAP2-201; intron 6
Database links

Mature sequence gga-miR-6551-5p

Accession MIMAT0025609
Sequence

26 - 

cggugcaucucugcagcccgca

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6551-3p

Accession MIMAT0025610
Sequence

67 - 

gggcugugagagauguucccuu

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).