Stem-loop sequence gga-mir-6552

AccessionMI0022370 (change log)
DescriptionGallus gallus miR-6552 stem-loop
Stem-loop
   -------- uc   --gcc    u              gg          u   ag 
5'         c  ucu     caac cuccagucugucca  ucuuguugga ggc  c
           |  |||     |||| ||||||||||||||  |||||||||| |||   
3'         g  aga     guug gaggucagacaggu  agaacaacuu ccg  a
   aaagaaca uc   acuuc    c              ga          u   ac 
Get sequence
Deep sequencing
985 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 45270643-45270746 [+]
sense
ENSGALT00000017675 ; UNC79-201; intron 28
Database links

Mature sequence gga-miR-6552-5p

Accession MIMAT0025611
Sequence

20 - 

gucuguccaggucuuguugga

 - 40

Get sequence
Deep sequencing508 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6552-3p

Accession MIMAT0025612
Sequence

57 - 

caacaagaaguggacagacug

 - 77

Get sequence
Deep sequencing462 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).