Stem-loop sequence gga-mir-6553

AccessionMI0022371 (change log)
DescriptionGallus gallus miR-6553 stem-loop
Stem-loop
   uc   g c   c ga c u            c u u a   c    u  ugc 
5'   uga g ugg g  g g gccaggagcagc c g g uag uguu gc   u
     ||| | ||| |  | | |||||||||||| | | | ||| |||| ||   a
3'   acu c acc c  c c cgguccucgucg g c c auc acaa cg   a
   -a   g -   - ua - u            a u - c   -    -  ucc 
Get sequence
Deep sequencing
149 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6553-5p

Accession MIMAT0025613
Sequence

26 - 

agcagcccugugauagcuguuugc

 - 49

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6553-3p

Accession MIMAT0025614
Sequence

61 - 

aacacuacccugagcugcucc

 - 81

Get sequence
Deep sequencing141 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).