Stem-loop sequence gga-mir-6555

AccessionMI0022374 (change log)
DescriptionGallus gallus miR-6555 stem-loop
Stem-loop
   uucuag  -ga        uu     a    ca   c     ac     ac 
5'       ga   ucccuguc  uucug ucug  gag ccaca  uagag  a
         ||   ||||||||  ||||| ||||  ||| |||||  |||||   
3'       cu   agggguag  gagac agac  cuc ggugu  aucuu  g
   ---cca  aga        uu     g    aa   c     aa     au 
Get sequence
Deep sequencing
686 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 167040277-167040376 [-]
sense
ENSGALT00000027419 ; ENOX1-201; intron 1
Database links

Mature sequence gga-miR-6555-5p

Accession MIMAT0025619
Sequence

25 - 

gaucugcagagcccacaacuag

 - 46

Get sequence
Deep sequencing34 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6555-3p

Accession MIMAT0025620
Sequence

60 - 

aauguggccucaacagagcag

 - 80

Get sequence
Deep sequencing644 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).