Stem-loop sequence gga-mir-6556

AccessionMI0022375 (change log)
DescriptionGallus gallus miR-6556 stem-loop
Stem-loop
   --    c  a    gcucu        aa          c    -     uccuc   u 
5'   gaug gc gaga     ccgggcgg  ggcugcucgg ccgc gcugc     gcg c
     |||| || ||||     ||||||||  |||||||||| |||| |||||     ||| c
3'   uugc cg cucu     ggcucgcc  ucgacgagcc ggcg cggcg     cgc u
   cg    -  a    -----        -c          u    g     -----   c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 23720897-23721002 [-]
intergenic
Database links

Mature sequence gga-miR-6556-5p

Accession MIMAT0025621
Sequence

26 - 

aaggcugcucggcccgcgcugc

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6556-3p

Accession MIMAT0025622
Sequence

66 - 

ggcggcgguccgagcagcuccc

 - 87

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).