Stem-loop sequence gga-mir-6558

AccessionMI0022376 (change log)
DescriptionGallus gallus miR-6558 stem-loop
Stem-loop
   cagguguggcaucgcgcugaaauacu    a    ----g  -   ----      aa    u    u        g 
5'                           gugg cacu     uc gac    caagug  acgu gagg ggcuuguu a
                             |||| ||||     || |||    ||||||  |||| |||| |||||||| u
3'                           uauc guga     ag cug    guucac  ugcg uucu ccggauaa c
   -------------------------c    a    augaa  a   uuaa      ga    -    u        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 15205927-15206048 [+]
sense
ENSGALT00000012419 ; PSMD1-201; intron 12
antisense
ENSGALT00000012451 ; gga-mir-6558-201; exon 3
Database links

Mature sequence gga-miR-6558-5p

Accession MIMAT0025623
Sequence

43 - 

aagugaaacguugagguggcuugu

 - 66

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6558-3p

Accession MIMAT0025624
Sequence

76 - 

aggccuucuugcguagcacuuga

 - 98

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).