Stem-loop sequence gga-mir-6559

AccessionMI0022377 (change log)
DescriptionGallus gallus miR-6559 stem-loop
Stem-loop
   aaugugccuuaggaaagggaau gg   g   a        uu  -    cuu    u 
5'                       g  uug gag aagaguca  ac cuga   cuug u
                         |  ||| ||| ||||||||  || ||||   ||||  
3'                       c  gac uuc uucucagu  ug gacu   gggc a
   -----auucaagacgagcgguu uu   g   c        --  a    -uc    u 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 133113085-133113193 [-]
sense
ENSGALT00000027073 ; LONRF2-201; exon 11
Database links

Mature sequence gga-miR-6559-5p

Accession MIMAT0025625
Sequence

27 - 

ugggagaaagagucauuaccuga

 - 49

Get sequence
Deep sequencing38 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6559-3p

Accession MIMAT0025626
Sequence

69 - 

agaguugacucuuccuugcagu

 - 90

Get sequence
Deep sequencing27 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).