Stem-loop sequence gga-mir-6560

AccessionMI0022378 (change log)
DescriptionGallus gallus miR-6560 stem-loop
Stem-loop
   ccacaaugca     ag    g  a     u  --     a  g    c   cu  ac 
5'           gucug  gcug ug ugugu gc  uccau cu uggu ugu  gu  u
             |||||  |||| || ||||| ||  ||||| || |||| |||  ||   
3'           cagac  cgac ac acacg cg  aggua gg acca acg  ca  u
   --ccgguaaa     -g    a  c     u  cc     -  -    u   -u  cc 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6560-5p

Accession MIMAT0025627
Sequence

26 - 

uguguugcuccauacuguggucu

 - 48

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6560-3p

Accession MIMAT0025628
Sequence

67 - 

uaccaggauggaccgcugcacacc

 - 90

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).