Stem-loop sequence gga-mir-6564

AccessionMI0022381 (change log)
DescriptionGallus gallus miR-6564 stem-loop
Stem-loop
   ca   u     c   ug aa     - g             cg    cugc 
5'   ugc auuuc ugc  g  agccu c ccgugcuuucucc  ccgu    c
     ||| ||||| |||  |  ||||| | |||||||||||||  ||||     
3'   acg uggag aug  c  ucgga g ggcgcgaaggagg  ggua    a
   -g   -     -   gu -g     c -             ca    cuuu 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 11146403-11146500 [-]
sense
Database links

Mature sequence gga-miR-6564-5p

Accession MIMAT0025633
Sequence

26 - 

cgccgugcuuucucccgccgu

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6564-3p

Accession MIMAT0025634
Sequence

58 - 

uggacggaggaagcgcgggcag

 - 79

Get sequence
Deep sequencing18 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).