Stem-loop sequence gga-mir-6565

AccessionMI0022382 (change log)
DescriptionGallus gallus miR-6565 stem-loop
Stem-loop
   ------------cua     uauu   uaaa     aua    a     cu     gu 
5'                gucug    ccu    augag   gcaa gcaca  ucagu  a
                  |||||    |||    |||||   |||| |||||  |||||   
3'                caggu    gga    uacuc   uguu cgugu  aguua  u
   uuuguagaaggucca     uuuc   ----     aug    -     cu     ag 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 55504493-55504593 [+]
sense
ENSGALT00000024915 ; ZNF462-201; 3'UTR (exon 3)
Database links

Mature sequence gga-miR-6565-5p

Accession MIMAT0025635
Sequence

20 - 

augagauagcaaagcacacuuc

 - 41

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6565-3p

Accession MIMAT0025636
Sequence

56 - 

ucugugcuuguguacucauag

 - 76

Get sequence
Deep sequencing54 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).