Stem-loop sequence gga-mir-6566

AccessionMI0022383 (change log)
DescriptionGallus gallus miR-6566 stem-loop
Stem-loop
   ga  c ucuu      a  a       a     g   u   auuc      uuuc 
5'   gc g    uguccg ga gcgguug ggccc aug guc    cuggau    u
     || |    |||||| || ||||||| ||||| ||| |||    ||||||     
3'   cg c    gcaggc cu cgucgac cuggg uac cgg    gaccua    c
   -a  u --uu      -  -       g     g   -   --ac      cugu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr16: 522800-522903 [-]
sense
ENSGALT00000045409 ; 3'UTR (exon 4)
chr16: 550656-550759 [-]
sense
ENSGALT00000045409 ; 3'UTR (exon 4)
chr16: 575849-575952 [+]
sense
ENSGALT00000045409 ; 3'UTR (exon 4)
AADN04000838.1: 6033-6136 [+]
sense
ENSGALT00000045409 ; 3'UTR (exon 4)
AADN04002392.1: 13341-13444 [-]
sense
ENSGALT00000045409 ; 3'UTR (exon 4)
Database links

Mature sequence gga-miR-6566-5p

Accession MIMAT0025637
Sequence

27 - 

gaggcccgaugugucauuccu

 - 47

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6566-3p

Accession MIMAT0025638
Sequence

65 - 

cagcaggccauggggucgcag

 - 85

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).