Stem-loop sequence gga-mir-3594

AccessionMI0022385 (change log)
DescriptionGallus gallus miR-3594 stem-loop
Stem-loop
   ucccacac  c  c  u   cau  ag         ----  u     ---c    ac 
5'         ag gg gg gcc   gg  cacagccca    ug cagag    agug  c
           || || || |||   ||  |||||||||    || |||||    ||||  c
3'         uc cc cc cgg   cc  gugucgggu    ac gucuc    ucgc  c
   --acccua  -  -  c   uuu  cu         cgcu  -     uacc    ga 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04001051.1: 3028-3134 [+]
intergenic
AADN04003906.1: 5670-5776 [-]
intergenic
Database links

Mature sequence gga-miR-3594-5p

Accession MIMAT0025641
Sequence

27 - 

gcacagcccaugucagagcagug

 - 49

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-3594-3p

Accession MIMAT0025642
Sequence

66 - 

ucugcaucgcugggcugugucc

 - 87

Get sequence
Deep sequencing66 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).