Stem-loop sequence gga-mir-6568

AccessionMI0022386 (change log)
DescriptionGallus gallus miR-6568 stem-loop
Stem-loop
   ----------     ugc     c   -  g   c          c   c  ccg 
5'           ccggc   ccgcc acc cc cgg cgccaucuug uug gg   g
             |||||   ||||| ||| || ||| |||||||||| ||| ||    
3'           ggccg   ggcgg ugg gg gcc gcgguagaac aac cc   c
   accccaccac     --u     u   c  -   c          c   a  cau 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 55382995-55383092 [+]
intergenic
Database links

Mature sequence gga-miR-6568-5p

Accession MIMAT0025643
Sequence

20 - 

gcggccgccaucuugcuugcg

 - 40

Get sequence
Deep sequencing15 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6568-3p

Accession MIMAT0025644
Sequence

52 - 

acaaccaagauggcgcccgggc

 - 73

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).