Stem-loop sequence gga-mir-6569

AccessionMI0022387 (change log)
DescriptionGallus gallus miR-6569 stem-loop
Stem-loop
   -----ga    ug ----   -a   g       -   g ac    -ggc       u 
5'        ggcc  g    ggc  cuc cggcccu guu g  uaac    guugcug u
          ||||  |    |||  ||| ||||||| ||| |  ||||    ||||||| c
3'        uugg  c    ccg  gag guugggg cag c  auug    caaugac u
   uaggaga    gu uuuu   cc   -       u   g --    aguu       g 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 4700575-4700678 [+]
intergenic
Database links

Mature sequence gga-miR-6569-5p

Accession MIMAT0025645
Sequence

20 - 

gcccuguuggacuaacggcguug

 - 42

Get sequence
Deep sequencing15 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6569-3p

Accession MIMAT0025646
Sequence

57 - 

cuugaguuacggacugggguugg

 - 79

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).