Stem-loop sequence gga-mir-6570

AccessionMI0022388 (change log)
DescriptionGallus gallus miR-6570 stem-loop
Stem-loop
   --------aaaacc     uu     -aa  a     u  a   g a       a 
5'               cuggu  ggauu   gg cccac gg ucu c ucuucca a
                 |||||  |||||   || ||||| || ||| | |||||||  
3'               gacca  ccuaa   cc gggug cc aga g agagggu c
   ccguaccacgucac     -c     aga  -     u  g   g -       u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 185065707-185065806 [+]
sense
ENSGALT00000027799 ; MAML2-201; intron 1
Database links

Mature sequence gga-miR-6570-5p

Accession MIMAT0025647
Sequence

20 - 

aggacccacuggaucugcaucuuc

 - 43

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6570-3p

Accession MIMAT0025648
Sequence

54 - 

agaggagagccugugggccaga

 - 75

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).