Stem-loop sequence gga-mir-6571

AccessionMI0022389 (change log)
DescriptionGallus gallus miR-6571 stem-loop
Stem-loop
   ----ucauuug ug  -uug     -g         --u   a   -    ggaaau  g 
5'            u  gc    agguu  uaaagcugu   ugg ucu ucag      ug c
              |  ||    |||||  |||||||||   ||| ||| ||||      ||  
3'            a  cg    uccaa  guuucgaca   acc aga aguc      ac a
   ccgucuuauaa gu  uuaa     aa         uac   -   g    ------  a 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 64574423-64574528 [+]
sense
ENSGALT00000020859 ; TXNDC5-201; intron 4
Database links

Mature sequence gga-miR-6571-5p

Accession MIMAT0025649
Sequence

21 - 

guaaagcuguuuggaucuucag

 - 42

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6571-3p

Accession MIMAT0025650
Sequence

58 - 

ugagagaccacauacagcuuugaaa

 - 82

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).