Stem-loop sequence gga-mir-6572

AccessionMI0022390 (change log)
DescriptionGallus gallus miR-6572 stem-loop
Stem-loop
   cucuuggaugugaauuuc         uu    c     g  gu    uc uaac 
5'                   guccuccuu  cccu ucugu ca  ucug  c    u
                     |||||||||  |||| ||||| ||  ||||  |    g
3'                   caggaggag  ggga agaca gu  agac  g    a
   --aguucugucuaacaga         -u    u     g  --    gu cuuc 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 145759818-145759925 [-]
intergenic
Database links

Mature sequence gga-miR-6572-5p

Accession MIMAT0025651
Sequence

26 - 

uuuucccucucugugcaguucug

 - 48

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6572-3p

Accession MIMAT0025652
Sequence

67 - 

agauggacagauagggugagga

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).