Stem-loop sequence gga-mir-6573

AccessionMI0022391 (change log)
DescriptionGallus gallus miR-6573 stem-loop
Stem-loop
   --------cugu   -   ug ga     g       g    -  u     ugcc     aau  g 
5'             gcu gug  g  cuguu gagaagu aggg gc cucug    gugga   gc g
               ||| |||  |  ||||| ||||||| |||| || |||||    |||||   || u
3'             ugg cac  c  gacag cucuuca ucuc cg gaggc    uaccu   cg g
   uuucguaauugg   u   gu gg     g       g    a  -     ----     -cu  a 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr27: 1690903-1691021 [+]
sense
ENSGALT00000040725 ; GPATCH8-201; intron 2
Database links

Mature sequence gga-miR-6573-5p

Accession MIMAT0025653
Sequence

20 - 

uggagaagugaggggcucucug

 - 41

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6573-3p

Accession MIMAT0025654
Sequence

71 - 

ggaggcacucugacuucucgga

 - 92

Get sequence
Deep sequencing13 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).