Stem-loop sequence gga-mir-6574

AccessionMI0022392 (change log)
DescriptionGallus gallus miR-6574 stem-loop
Stem-loop
   --a     acauu      uc        u   u          a    --u   -  a 
5'    acaug     gugucc  agagacau ccu gucuuuucug agac   gug ag g
      |||||     ||||||  |||||||| ||| |||||||||| ||||   ||| ||  
3'    uguac     uauagg  ucucugua gga cagaaaagau ucug   cgc uc u
   uca     ----c      --        -   -          g    ugu   g  g 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 7623645-7623751 [-]
intergenic
Database links

Mature sequence gga-miR-6574-5p

Accession MIMAT0025655
Sequence

26 - 

auuccuugucuuuucugaaga

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6574-3p

Accession MIMAT0025656
Sequence

66 - 

ugucuguagaaaagacaggaugu

 - 88

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).