Stem-loop sequence gga-mir-6575

AccessionMI0022393 (change log)
DescriptionGallus gallus miR-6575 stem-loop
Stem-loop
   c     u   cag    c      uu                     ugga  g  u 
5'  ucugc agg   aauc uuuggu  ugucagcuuggggaagcucuu    gc uu u
    ||||| |||   |||| ||||||  |||||||||||||||||||||    || ||  
3'  agaug ucc   uuag agauca  guagucggacccuuuugagga    cg aa g
   u     -   ---    a      cu                     ----  g  a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 2623651-2623758 [-]
sense
ENSGALT00000044748 ; SNUPN-201; intron 7
Database links

Mature sequence gga-miR-6575-5p

Accession MIMAT0025657
Sequence

26 - 

uugucagcuuggggaagcucuu

 - 47

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6575-3p

Accession MIMAT0025658
Sequence

68 - 

gaguuuucccaggcugauguca

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).