Stem-loop sequence gga-mir-6576

AccessionMI0022394 (change log)
DescriptionGallus gallus miR-6576 stem-loop
Stem-loop
   -------c   a                 u  uu    cu  a      gaaggua 
5'         uac agcaguguguuuucuca gg  guau  ga cacuuu       a
           ||| ||||||||||||||||| ||  ||||  || ||||||       a
3'         gug uugucguacaagagagu cc  uaug  cu gugaaa       u
   cuaccauc   a                 u  cu    -u  -      agguaaa 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr22: 60609-60714 [+]
sense
ENSGALT00000000026 ; AAK1-201; intron 4
Database links

Mature sequence gga-miR-6576-5p

Accession MIMAT0025659
Sequence

20 - 

ucaugguuguaucugaacacuuu

 - 42

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6576-3p

Accession MIMAT0025660
Sequence

62 - 

agugucuguauucccuugag

 - 81

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).