Stem-loop sequence gga-mir-6577

AccessionMI0022395 (change log)
DescriptionGallus gallus miR-6577 stem-loop
Stem-loop
   -------   ca    caaa    uggca    c     u    u         uca 
5'        ggg  uccc    cucc     ucuu uacuc guuu cuucugugu   a
          |||  ||||    ||||     |||| ||||| |||| |||||||||   u
3'        cuc  aggg    gagg     agga auggg caga gaagacgua   a
   ccuuuuc   aa    ucua    -uggg    u     u    -         cac 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 17227036-17227143 [+]
intergenic
Database links

Mature sequence gga-miR-6577-5p

Accession MIMAT0025661
Sequence

21 - 

caucuucuacucuguuuucuucu

 - 43

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6577-3p

Accession MIMAT0025662
Sequence

64 - 

agagacuggguauaggagggu

 - 84

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).