Stem-loop sequence gga-mir-6578

AccessionMI0022396 (change log)
DescriptionGallus gallus miR-6578 stem-loop
Stem-loop
   -------uguc    -uuu     ua   -  u  -        u     cc  u 
5'            uugc    guagc  cca gc gu ggcagagu cucca  ag g
              ||||    |||||  ||| || || |||||||| |||||  || a
3'            agcg    cgucg  ggu cg ca ucgucuca ggggu  uc g
   gugugcccucu    uuuu     uc   u  c  g        c     -a  a 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 105429051-105429152 [+]
sense
ENSGALT00000026714 ; HADHB-201; 3'UTR (exon 9)
Database links

Mature sequence gga-miR-6578-5p

Accession MIMAT0025663
Sequence

20 - 

cagcuguggcagaguucucca

 - 40

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6578-3p

Accession MIMAT0025664
Sequence

55 - 

gggcacucugcugaccgcuuggc

 - 77

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).