Stem-loop sequence gga-mir-6579-1

AccessionMI0022397 (change log)
DescriptionGallus gallus miR-6579-1 stem-loop
Gene family MIPF0001492; mir-6579
Stem-loop
   -     ------      c   -------ca        ca    c   c  c  ac   cgc 
5'  gaggu      gagcgc gug         acgccgug  acgc gug aa gc  cug   g
    |||||      |||||| |||         ||||||||  |||| ||| || ||  |||    
3'  cuccg      cuugcg cac         ugcggcac  ugcg cac uu cg  gac   g
   a     cgacuc      u   auuuguccg        aa    a   u  a  ga   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 500362-500475 [-]
sense
ENSGALT00000044022 ; TMEM80-201; intron 1
Database links

Mature sequence gga-miR-6579-5p

Accession MIMAT0025665
Sequence

26 - 

caacgccgugcaacgcaccug

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6579-3p

Accession MIMAT0025666
Sequence

56 - 

agaggcauuucacagcguaaca

 - 77

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).