Stem-loop sequence gga-mir-6581

AccessionMI0022400 (change log)
DescriptionGallus gallus miR-6581 stem-loop
Stem-loop
   gaccccaucccgcugcagcgggagaguagu       -g   ag   u    gaa 
5'                               gagcuca  agg  gac gggg   a
                                 |||||||  |||  ||| ||||    
3'                               uucgggu  ucc  cug uccc   g
   --------aagagucguaguugaaggguuu       gg   cu   -    gac 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 48389947-48390048 [-]
intergenic
Database links

Mature sequence gga-miR-6581-5p

Accession MIMAT0025669
Sequence

28 - 

agugagcucagaggaggacuggg

 - 50

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6581-3p

Accession MIMAT0025670
Sequence

63 - 

ugucucccuggugggcuuuuu

 - 83

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).