Stem-loop sequence gga-mir-6582

AccessionMI0022401 (change log)
DescriptionGallus gallus miR-6582 stem-loop
Stem-loop
   uc   ----g       a  ------    u             u  a    cu uu 
5'   agu     uuguugc uc      cugu agagagacacuca ag gagu  u  c
     |||     ||||||| ||      |||| ||||||||||||| || ||||  |   
3'   ucg     gauaaug ag      gacg ucucuuugugggu uc cuca  g  a
   -u   aagaa       g  ucaaaa    u             c  a    au ac 
Get sequence
Deep sequencing
339 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 57474216-57474320 [+]
sense
ENSGALT00000004401 ; MED23-201; 3'UTR (exon 2)
Database links

Mature sequence gga-miR-6582-5p

Accession MIMAT0025671
Sequence

20 - 

uuagagagacacucauagag

 - 39

Get sequence
Deep sequencing28 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6582-3p

Accession MIMAT0025672
Sequence

58 - 

cacucuggguguuucucuugcag

 - 80

Get sequence
Deep sequencing310 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).