Stem-loop sequence gga-mir-6584

AccessionMI0022404 (change log)
DescriptionGallus gallus miR-6584 stem-loop
Stem-loop
   gcaaaa   - -aaa   -a     c auc        ----cu           uacc 
5'       agg c    ggc  gcaca c   uggaaguu      gcagaugauga    u
         ||| |    |||  ||||| |   ||||||||      |||||||||||     
3'       ucc g    ucg  cgugu g   acuuucaa      cgucuacugcu    u
   --aguc   a aaac   ag     a -aa        uaaccu           ucuu 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 93858571-93858680 [-]
sense
ENSGALT00000022316 ; gga-mir-6584-201; exon 3
Database links

Mature sequence gga-miR-6584-5p

Accession MIMAT0025675
Sequence

26 - 

ucuggaaguucugcagaugauga

 - 48

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).