Stem-loop sequence gga-mir-6586

AccessionMI0022406 (change log)
DescriptionGallus gallus miR-6586 stem-loop
Stem-loop
   ugggcugacu      -  --u        g -     g  a     u     uuucc 
5'           gugguu uc   aaccaguu c ugcca au gaagu caccu     u
             |||||| ||   |||||||| | ||||| || ||||| |||||     a
3'           cauuag ag   uuggucga g auggu ua cuucg guggg     u
   ----ccuuuc      g  uuu        g u     a  c     -     uucga 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 69449240-69449349 [-]
intergenic
Database links

Mature sequence gga-miR-6586-5p

Accession MIMAT0025677
Sequence

27 - 

ugcugccagauagaaguucaccu

 - 49

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).