Stem-loop sequence gga-mir-6587

AccessionMI0022407 (change log)
DescriptionGallus gallus miR-6587 stem-loop
Stem-loop
   acgagcuccga    cug c     u         aaacc   c     c  ag u 
5'            ggca   c ccagu cuccagcgc     uca gcagg gg  c u
              ||||   | ||||| |||||||||     ||| ||||| ||  | g
3'            ucgu   g ggucg gaggucgug     ggu cgucc cc  g g
   ---cuuucaua    cca a     -         gugaa   -     -  ga u 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 26193022-26193130 [-]
sense
ENSGALT00000032630 ; gga-mir-6587-201; exon 1
Database links

Mature sequence gga-miR-6587-5p

Accession MIMAT0025678
Sequence

26 - 

ucuccagcgcaaaccucacgcag

 - 48

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6587-3p

Accession MIMAT0025679
Sequence

68 - 

ugcuggaaguggugcuggaggcu

 - 90

Get sequence
Deep sequencing20 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).