Stem-loop sequence gga-mir-6588

AccessionMI0022408 (change log)
DescriptionGallus gallus miR-6588 stem-loop
Stem-loop
   ggggcugagcagggagcuccugcccucagcug       -a      g   --     cac 
5'                                 cucuucc  cagccu agc  ugugu   c
                                   |||||||  |||||| |||  |||||    
3'                                 gagaagg  gucggg ucg  acaca   u
   ----------uuuccuuugucuugacuuuuag       gg      -   uu     acc 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 17553409-17553518 [-]
intergenic
Database links

Mature sequence gga-miR-6588-3p

Accession MIMAT0025680
Sequence

69 - 

uugcugggcugggggaagaggau

 - 91

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).