Stem-loop sequence gga-mir-6589

AccessionMI0022409 (change log)
DescriptionGallus gallus miR-6589 stem-loop
Stem-loop
   -----------ccc    aau  uu      gcuucuguu             u       -   ug 
5'               gaga   gu  ugugaa         gauggagauggug gaagcag aag  u
                 ||||   ||  ||||||         ||||||||||||| ||||||| |||   
3'               cucu   cg  acacuu         cuacuucuaucgu cuucguc uuu  g
   ugucaggaaacagu    ---  -u      ---------             -       a   uu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 11215738-11215847 [-]
sense
ENSGALT00000043640 ; WTIP-201; intron 2
Database links

Mature sequence gga-miR-6589-5p

Accession MIMAT0025681
Sequence

29 - 

ugauggagauggugugaagcaga

 - 51

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).