Stem-loop sequence gga-mir-6590

AccessionMI0022410 (change log)
DescriptionGallus gallus miR-6590 stem-loop
Stem-loop
   -ua      ccuacaa      uaaaua   -       u  u   a     cuac 
5'    uguuuc       guaguu      ugg gaucagg gc gaa uaaga    u
      ||||||       ||||||      ||| ||||||| || ||| |||||    u
3'    acaaag       cgucgg      acu cuagucc ug cuu auuuu    c
   acg      ------a      ---ucg   a       u  u   c     auuu 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 46491259-46491362 [-]
sense
ENSGALT00000018063 ; ATG2B-201; exon 41
Database links

Mature sequence gga-miR-6590-5p

Accession MIMAT0025682
Sequence

28 - 

ugggaucaggugcugaaauaaga

 - 50

Get sequence
Deep sequencing22 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6590-3p

Accession MIMAT0025683
Sequence

64 - 

uuacuucuguuccugaucauca

 - 85

Get sequence
Deep sequencing33 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).