Stem-loop sequence gga-mir-6592

AccessionMI0022412 (change log)
DescriptionGallus gallus miR-6592 stem-loop
Stem-loop
   -gaggag   -  gag      c   ga         c u    ca     g  ag 
5'        cgc cu   ccgcgg gac  ggccgucag c ggag  guucu cg  g
          ||| ||   |||||| |||  ||||||||| | ||||  ||||| ||   
3'        gcg ga   ggcgcc cug  ccggcaguc g ccuc  cgaga gu  u
   uggagga   a  -gg      -   gg         c c    ug     g  cg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 3182036-3182145 [+]
sense
ENSGALT00000002350 ; ZZEF1-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-6592-3p

Accession MIMAT0025685
Sequence

64 - 

agcgucucccgccugacggcc

 - 84

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).