Stem-loop sequence gga-mir-6593

AccessionMI0022413 (change log)
DescriptionGallus gallus miR-6593 stem-loop
Stem-loop
   -----c gg     c    c   ggg   u    --      -u   c     u u  g  u 
5'       g  cggug ggug ugu   ugc ggga  gggcuc  gug ggcuc g gc gc c
         |  ||||| |||| |||   ||| ||||  ||||||  ||| ||||| | || || u
3'       c  gccgc ccau aua   acg cccu  cucgag  cac ccggg c cg cg g
   uagcuu ag     -    u   aag   u    gu      cc   -     u u  g  u 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 1402699-1402815 [-]
sense
ENSGALT00000045894 ; CCDC94-201; 3'UTR (exon 2)
Database links

Mature sequence gga-miR-6593-5p

Accession MIMAT0025686
Sequence

22 - 

ugcugggagggcucugugcggcu

 - 44

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6593-3p

Accession MIMAT0025687
Sequence

76 - 

cgagcucugucccugcag

 - 93

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).