Stem-loop sequence gga-mir-6594

AccessionMI0022414 (change log)
DescriptionGallus gallus miR-6594 stem-loop
Stem-loop
   ------------   g  u    c   aggg   -                u gc     uu 
5'             ucu cu ugca cac    uug gggguggcgugaguug g  ugggc  u
               ||| || |||| |||    ||| |||||||||||||||| |  |||||   
3'             gga ga acgu gug    gac cccuacuguacucgac c  acccg  g
   gggguaucacgg   g  c    a   ---g   a                u uc     ug 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 598336-598445 [+]
sense
ENSGALT00000007282 ; STARD8-201; 3'UTR (exon 9)
Database links

Mature sequence gga-miR-6594-5p

Accession MIMAT0025688
Sequence

21 - 

uggggguggcgugaguugugg

 - 41

Get sequence
Deep sequencing23 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).