Stem-loop sequence gga-mir-6596

AccessionMI0022416 (change log)
DescriptionGallus gallus miR-6596 stem-loop
Stem-loop
   -cccucag g     ----g       aggg      -    -   uuc 
5'         g cgggg     cgggacg    ccgagc ccgg gcc   c
           | |||||     |||||||    |||||| |||| |||   c
3'         c guccc     gcccugc    ggcucg ggcc cgg   g
   aaauugca g     acgaa       ggca      a    u   cuc 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 10770945-10771038 [-]
antisense
ENSGALT00000038774 ; gga-mir-6596-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-6596-5p

Accession MIMAT0025690
Sequence

26 - 

gccgagcccgggccuuccc

 - 44

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6596-3p

Accession MIMAT0025691
Sequence

54 - 

cggagcucggacggcgucccga

 - 75

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).