Stem-loop sequence gga-mir-6597

AccessionMI0022417 (change log)
DescriptionGallus gallus miR-6597 stem-loop
Stem-loop
   gagagacg  agaa   -     a   ---     g c     -     cc  cuu       
5'         gg    cuc accuc gcc   ccggc c cugcg cgggg  gg   guagca 
           ||    ||| ||||| |||   ||||| | ||||| |||||  ||   ||||| g
3'         cc    gag ugggg cgg   ggccg g gaugc guccc  cc   cgucgu 
   ------cg  gacg   a     a   ccc     - a     a     uu  ---       
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 11097596-11097705 [-]
antisense
ENSGALT00000012067 ; CTSZ-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-6597-3p

Accession MIMAT0025692
Sequence

65 - 

ccuucccugacguagaggccggcc

 - 88

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).