Stem-loop sequence gga-mir-6598

AccessionMI0022418 (change log)
DescriptionGallus gallus miR-6598 stem-loop
Stem-loop
   ccccug    --a    cug        gc          a  -     uuuuuac   a 
5'       uggc   gccu   gcacagcu  agcaagggag ag ucugc       acc u
         ||||   ||||   ||||||||  |||||||||| || |||||       ||| c
3'       gcug   cgga   cgugucgg  ucguuuucuc uc agacg       ugg c
   ----ag    gaa    ---        ac          g  g     ---ucau   u 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 37909792-37909901 [-]
sense
ENSGALT00000016629 ; ABCD4-201; intron 3
Database links

Mature sequence gga-miR-6598-5p

Accession MIMAT0025693
Sequence

26 - 

ugcagcaagggagaagucugc

 - 46

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).