Stem-loop sequence gga-mir-6600

AccessionMI0022419 (change log)
DescriptionGallus gallus miR-6600 stem-loop
Stem-loop
   ggccaugcuggga    gg      ca   caa         -augg u       -  aa 
5'              uucu  ggaagg  agg   gugggagcc     c cugcagc ug  c
                ||||  ||||||  |||   |||||||||     | ||||||| ||   
3'              aaga  ucuucc  ucc   cacccucgg     g gacguug ac  a
   ---------ugua    --      cc   -ua         gcaga u       u  ag 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 5837823-5837932 [-]
intergenic
Database links

Mature sequence gga-miR-6600-3p

Accession MIMAT0025694
Sequence

69 - 

ugcagugagacgggcucccacau

 - 91

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).